WEBQUEST

Genetic Disease

Introduction and Task

You are members of an elite medical investigation team, called into action because of a high number of mysterious infant deaths in a remote community in New Mexico. It is unclear whether the deaths are a result of an infectious disease or an inherited gene.. As part of your investigation, your tasks are to determine the cause of these deaths and what can be done to save the lives of other children in this community.

The preliminary investigation revealed that all of the afflicted infants had two copies of the DNA sequence shown below. In addition, the parents of the infants all mentioned that the children had sweat that seemed to be saltier than normal. It is your task to discover the significance of this DNA sequence, determine how it relates to those with the disease, and describe its symptoms and possible treatments. You will then prepare a report to inform public officials of the outcome of your investigation.

TGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCT
GTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGA
TGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTG
CAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCA
AGAATTTCTTTAGCAAGAGCAGTATA

For this project you will break into groups of four Each team will use the Koshland Science Museum website as a resource to investigate DNA technology and perform a computational analysis of the DNA sequence that was found in the sick infants.. Using the attached worksheet as a guide, work as a group to complete the following tasks

Next: Group Activity