Putting DNA to Work
Genetic Disease
 Do these tasks as a group and complete the Group Worksheet.
1) Learn about DNA technology in the Introduction and Criminology sections of the website. What kind of biological samples could have been used to collect the DNA from the sick infants? How similar is human DNA to that of other species?
Read the Introduction to the Putting DNA to Work exhibit
Read about DNA evidence in the Putting DNA to Work exhibit
2) Go through the DNA Sequence portion of the website. Pay particular attention to the Probe the Sequence activity. What is the relationship between the size of the probe and the amount of times it occurs in the sequence?
Sequence information in the Putting DNA to Work exhibit
3) In the Probe the Sequence activity, you searched a fairly small stretch of DNA (about 1500 bases) for three or six base combinations. This is called a blast search. Now you are going to blast the DNA sequence from the sick infants against the entire human genome, which contains 3 billion base pairs -- just as scientists must when they investigate. The blast search compares the DNA sequence from the sick children to all known DNA sequences in the human genome.
TGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTT
CTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGATGAATA
TAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAG
ACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAG
CAAGAGCAGTATA
• Go to the DNA blast search at the National Center for Biotechnology Information website below.
http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606
Copy and paste the DNA sequence for the sick children into the box with the title: “Enter an accession, gi, or a sequence in FASTA format:” and press the “Begin Search” button at the bottom of the page. You will be directed to another page, where you should press the “View Report” button.
After a few seconds, you will get several “hits.” Scroll down to the first result, “>ref|NT_007933.14|Hs7_8090,” and look at the comparison of the two DNA sequences. Your sequence is on the top row (Query) and the Blast result sequence (Subject) is underneath your sequence. How does your sequence compare to the known sequence? A vertical line between the two sequences indicates that they are identically matched. If no vertical line appears, it indicates that the sequence you entered has s a mistake, or a mutation. . What is missing from your sequence that is in the known sequence?
***Print out ONLY THE FIRST 2 PAGES and turn in with group report***
• Copy the blue text under “Features in this part of subject sequence” that gives the name of the gene (only up to the comma). Open the site below, paste the gene name into the white box, and press the “Go” button.
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM
***Print out ONLY THE FIRST PAGE and turn in with group report***
Click on the first link (*602421) to find out more about the gene and what disease it causes.
• Discover how the DNA sequence relates to the disease.
Click on the first link (*602421): this will tell you more about the gene and what disease it causes.
• Learn more about how the DNA sequence relates to the disease.
http://www.ygyh.org/cf/cause.htm
4) Learn more about inherited diseases at the Marian Koshland Science Museum.
Inherited Disease information in Putting DNA to Work exhibit
Give an example of an inherited disease and what kind of mutation causes it.
Next: Individual Roles
| 
